Op zoek naar intelligentie

April 26, 2016

Share this article:

Iedereen heeft het wel eens gehad. Je snapt niks van de stof, en een of andere bolleboos heeft alles meteen door. Je snapt niet hoe het komt dat anderen het wel snappen. En dat terwijl mensen misschien wel eens hetzelfde gevoel hebben gekregen van jou. Hoe komt het dat sommige mensen stof sneller snappen dan anderen? Het antwoord op deze vraag is dikwijls intelligentie. Maar wat is dat nou eigenlijk? En waar komt het uit voort?
Het antwoord op de vraag wat intelligentie überhaupt is, blijkt moeilijker te zijn dan verwacht. Gedurende de 20ste eeuw hebben vele psychologen geprobeerd vast te leggen wat intelligentie is. In 1904 kwam de Brit Charles Spearman – overigens ook de bedenker van Spearman’s \rho –  met zijn tweefactoren-theorie van intelligentie. Hij beweerde dat ieder mens een algemene intelligentie (g) bezat en daarnaast nog intelligenties (s) voor specifieke taken.
Enige tijd later kwam de Amerikaan Louis Thurstone met het idee dat er meerdere losstaande inteligenties zouden zijn, de zogenaamde PMAs (primary mental abilities). Thurstone onderzocht 56 verschillende mentale vermogens en concludeerde hieruit de aanwezigheid van 7 PMAs, namelijk: verbaal inzicht, woordenrijkdom, rekenkundig inzicht, visueel-ruimtelijk inzicht, associatief geheugen, waarnemingssnelheid en logisch redeneren. Statistisch onderzoek – door middel van factor analyse- wees uit dat al deze factoren in grote mate correleren met elkaar, wat spreekt voor de algemene intelligentie g van Spearman.
Howard Gardner publiceerde in 1983 een ander beeld van intelligentie, ook een pleidooi voor meerdere intelligentietypen, maar andere dan die van Thurstone: verbale intelligentie (taalslim), mathematische intelligentie (rekenslim), ruimtelijke intelligentie (beeldslim), muzikale intelligentie (muziekslim), lichamelijke intelligentie (beweegslim), interpersoonlijke intelligentie (samenslim), intrapersoonlijke intelligentie (zelfslim) en natuurgerichte intelligentie (natuurslim). Maar ook deze bleken sterk te correleren.
Robert Sternberg kwam met een iets andere invalshoek. Hij verdeelde intelligentie onder in zijn 3 factoren: creatieve intelligentie, praktische intelligentie en analytische intelligentie. Ook deze bleken uiteindelijk erg te correleren.
Al met al lijkt er dus geen sluitende definitie te zijn van intelligentie. Als gekeken wordt naar de definities die gegeven worden, wordt duidelijk dat de termen waarin intelligentie gedefinieerd wordt vaak zelf ook geen goede definitie hebben. Zo is mathematische intelligentie misschien nog wel te omvatten in een definitie, maar interpersoonlijke of praktische intelligentie in veel mindere mate. Toch lijken de vele definities van intelligentie sterk op elkaar en omsluiten vaak (deels) hetzelfde concept. Er mag dus misschien geen gehele overeenstemming zijn over wat intelligentie is en of er aparte intelligenties zijn, of dat deze altijd samen verschijnen, de overlap van de verschillende concepten geeft een heel aardig beeld van wat men met intelligentie bedoelt. Dit betekent dat intelligentie een concept blijft waarin we in de volksmond over kunnen spreken, maar zich niet goed leent voor academisch gebruik.

Inteligentie quotiënt

Gepaard met pogingen om intelligentie te definiëren gingen pogingen om intelligentie te meten. Maar hoe is intelligentie dan te meten? Dat wordt gedaan aan de hand van het intelligentie quotiënt, ofwel IQ. Het IQ werd voor het eerste gedefinieerd in 1912 door William Stern. Andere psychologen gingen verder met het concept en zo werden uiteindelijk de eerste IQ-tests ontwikkeld. Zo produceerde William Wechsler in 1939 uiteindelijk de eerste Wechsler intelligence scale (WISC), waarvan alle moderne IQ tests uiteindelijk zijn afgeleid. De IQ-tests werden gestandaardiseerd zodat ze bij benadering normaal verdeeld zijn met een standaard deviatie van 15 punten. De vraag rijst wat deze IQ-tests dan precies meten als de definitie van IQ niet duidelijk is. Eén mogelijk antwoord is de capaciteit om iets nieuws leren. Dit kan gedaan worden door deze persoon iets nieuws te leren en vervolgens te testen hoe goed deze persoon het kent.

Vraagtekens bij IQ-tests

Toch verschijnen er veel vragentekens bij IQ-tests, meten ze wel écht intelligentie? Motivatie zou bijvoorbeeld een rol kunnen spelen bij het slecht maken van een IQ-test. Een test met meer dan 2000 deelnemers wees bijvoorbeeld uit dat wanneer er een financiële beloning staat tegenover een goede score, een populatie gemiddeld soms wel 10 punten hoger haalde.

Empirisch onderzoek naar intelligentie

Met steeds modernere middelen voor empirisch onderzoek naar de mens, is men nu ook een verklaring gaan zoeken voor intelligentie.  Recent is gebleken dat onafhankelijk van de exacte definitie van intelligentie, neuro-beelden van het brein van mensen met hoge intelligentie afwijken van die met lagere intelligentie.
Een andere aanpak om intelligentie te zoeken is door naar het DNA te kijken. Intelligentie lijkt erfbaar en dus zou het in ons DNA vastgelegd zijn. Met de ontwikkeling van DNA sequentie methoden is het mogelijk om de volgorde van het menselijk genoom vast te leggen zodat deze bruikbaar is voor analyse.
Dit brengt ons bij het onalledaagse verhaal van Zhao Bowen. In de zomer van 2009 werd hij gescout op een zomerkamp van BGI Shenzen, een van de beste biotech instituten ter wereld met een specificatie in DNA-sequentie. Bowen wist binnen een paar dagen de programmeertaal Perl te leren en er complexe statistische vraagstukken mee op te lossen. Hierdoor erkende de kampleiding hem als een genie en werd hij gevraagd te stoppen met zijn middelbare school. Bowen mocht aan de slag gaan bij BGI.

150909-news-quanti-zhao

Zhao Bowen.


Inmiddels is Bowen 23 en leidt hij een miljoenenproject om het vraagstuk van intelligentie op te lossen. DNA-samples van duizenden extreem intelligente personen van over de hele wereld zijn naar zijn lab gestuurd voor analyse. Nu rest te onderzoeken wat ze allemaal gemeen hebben. Dit is een complexe versie van het longest common subsequence probleem. Het DNA is opgebouwd uit strings van adenine (A), guanine(G), cytosine (C) en thymine (T). Twee gesimplificeerde DNA strings kunnen dus weergegeven worden als:

GTCGTCGGGAGCAGGCCGAGG

GCCTGGCTGGAGAAAGCGTAA

Nu blijkt dus dat bepaalde  subsequenties van dergelijke strings coderen voor bepaalde eigenschappen, op deze manier zijn bepaalde ziektes herleid tot het DNA. Bij intelligentie is het iets complexer. Niemand is op dezelfde manier slim, zoals mensen wel allemaal op dezelfde manier ziek zijn. Bowen verwacht daarom geen intelligentie-gen te vinden. Hij denkt dat intelligentie zich op een aantal punten in het DNA uit, waardoor een afwijking op dit punt een mens slimmer of dommer maakt. Deze afwijkingen zouden additief zijn. Veel van de juiste afwijkingen geven dus intelligentie.
Het enige probleem is dat deze punten onderling van elkaar afhankelijk zijn. Zo zouden sommige punten elkaar versterken of verzwakken. Dit kan losjes vergeleken worden met de benodigdheden om goed te zijn in voetbal. Stel dat een persoon tactisch heel slim is, maar motorisch niet slim. Dan heeft hij op het ene punt dus wel de juiste benodigdheid, maar komt dit pas tot zijn recht als die op een ander punt ook de juiste benodigdheid heeft. Dit kan ervoor zorgen dat een persoon met veel benodigdheden voor intelligentie in zijn DNA toch een matige intelligentie heeft. Dit fenomeen heet epistasie en het maakt de DNA-analyse lastig voor Bowen.
Bowen heeft ‘s werelds beste DNA sequentie machines tot zijn beschikking en verwacht binnen 5 jaar meer dan een miljoen geschikte DNA’s te hebben om te analyseren.

Gevolgen van een gen voor DNA

Nadat internationale media aandacht gaven aan Bowen’s plannen om de sleutel te vinden voor intelligentie, werden direct ethische vragen opgeroepen. Zo zou het voor ouders die IVF (bevruchting in glas) gebruiken om zwanger te worden, mogelijk zijn om de slimste te kiezen uit een selectie van meerdere embryo’s.  Dit brengt een ethisch debat met zich mee. Toch kan het ook positief uitpakken. Net zoals nu albinisme al gescreend kan worden bij foetussen, zou dat door Bowen’s onderzoek ook kunnen bij Schizofrenie en bipolaire stoornissen.
Bowen zelf zegt alleen op zoek te zijn naar kennis. Hij vergelijkt zijn onderzoek met het onderzoek naar kwantummechanica dat de atoombom mogelijk maakt. Het onderzoek is er voor kennis waar je hele goede dingen mee kan doen of hele slechte dingen. Maar dit is niet waar de onderzoekers zich mee bezig moeten houden.
 


 Dit artikel is geschreven door Tim van Schaick

timvanschaik

 

Read more

Why your Dobble cards always match

Why your Dobble cards always match

Dobble: a game played by kids, but still very popular among adults. In the game, you have to draw two random cards and place them face-up on the table between all the players. Then, you have to look for the identical symbol between the two cards. Between every two...

Why do we count in base 10?

Why do we count in base 10?

What is two plus two? The realist will say four, the computer will say 100, and the cynic will say 5 – but which is correct? The reason we count in base 10 stems from the simplest fact: humans have 10 fingers. Understandable and logical, as this seems to be nature’s...